Ex Parte Tomatsu et al

Patent Trial and Appeal BoardOct 19, 2015

12120172 (P.T.A.B. Oct. 19, 2015)

UNITED STATES PATENT AND TRADEMARK OFFICE UNITED STATES DEPARTMENT OF COMMERCE United States Patent and Trademark Office Address: COMMISSIONER FOR PATENTS P.O. Box 1450 Alexandria, Virginia 22313-1450 www.uspto.gov APPLICATION NO. FILING DATE FIRST NAMED INVENTOR ATTORNEY DOCKET NO. CONFIRMATION NO. 12/120,172 05/13/2008 Nobuhiro Tomatsu 03500.153633. 4403 5514 7590 10/19/2015 FITZPATRICK CELLA HARPER & SCINTO 1290 Avenue of the Americas NEW YORK, NY 10104-3800 EXAMINER HANEY, AMANDA MARIE ART UNIT PAPER NUMBER 1634 MAIL DATE DELIVERY MODE 10/19/2015 PAPER Please find below and/or attached an Office communication concerning this application or proceeding. The time period for reply, if any, is set in the attached communication. PTOL-90A (Rev. 04/07) UNITED STATES PATENT AND TRADEMARK OFFICE ____________ BEFORE THE PATENT TRIAL AND APPEAL BOARD ____________ Ex parte NOBUHIRO TOMATSU, TOSHIFUMI FUKUI, NOBUYOSHI SHIMIZU, and ATSUSHI TAKAYANAGI1 ____________ Appeal 2013-001604 Application 12/120,172 Technology Center 1600 ____________ Before JEFFREY N. FREDMAN, ULRIKE W. JENKS, and ROBERT A. POLLOCK Administrative Patent Judges. JENKS, Administrative Patent Judge. DECISION ON APPEAL This is an appeal under 35 U.S.C. § 134 involving claims directed to a method and probes for detecting Epidermophyton floccosum. The Examiner rejects the claims on the ground of nonstatutory obviousness-type double patenting. We have jurisdiction under 35 U.S.C. § 6(b). We AFFIRM. 1 According to Appellants, the Real Party in Interest is Canon Kabushiki Kaisha. (App. Br. 4.) Appeal 2013-001604 Application 12/120,172 2 STATEMENT OF THE CASE The Specification discloses that “Epidermophyton floccosum can be detected while precisely distinguishing it from any of [other] fungi . . . , which may be more likely to cause cross contamination.” (Spec. ¶ 15, as amended Oct. 10, 2008.) “Conventional primers are used as PCR primers for amplifying the ITS [internal transcribed spacer] region on DNA to be used for detecting a pathogenic fungus. . . . Specifically, the conventional primers are . . . designed from regions common to fungi so as to carry out simultaneous amplification even when fungus species are different.” (Id. at ¶ 62.) “The probe . . . can react with the DNA sequence of an internal transcribed spacer (ITS) of the pathogenic fungus or a nucleic acid having a base sequence specific to the ITS region contained in a sample.” (Id. at ¶ 24.) Claims 8, 9, 12, 13, and 15 are on appeal, and can be found in the Claims Appendix of the Appeal Brief (App. Br. 18–20). Claim 8 is representative of the claims on appeal, and reads as follows (emphasis added): 8. A probe set for detecting an internal transcribed spacer (ITS) region of Epidermophyton floccosum which is a pathogenic fungus in a sample, wherein the probe set comprises each of the following probes (1) to (4): (1) a probe consisting of tctctctgaatgctggacggtgtc (SEQ ID No: 1) or the complementary sequence thereof; (2) a probe consisting of ctcgccgaaggagtgattctcaga (SEQ ID No: 2) or the complementary sequence thereof; (3) a probe consisting of ttccaccgggagaggagaaagg (SEQ ID No: 3) or the complementary sequence thereof; and (4) a probe consisting of acaaaaccagcgccttcaggac (SEQ ID No: 4) or the complementary sequence thereof. Appeal 2013-001604 Application 12/120,172 3 Appellants seek review of the Examiner’s rejection of claims 8, 9, 12, 13, and 15 on the ground of ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1–10 of Fukui.2 (App. Br. 11.) For the purposes of our analysis, claim 8 is representative. (See App. Br. 12.) Analysis We adopt the Examiner’s findings of fact and reasoning regarding the scope and content of Fukui and agree that the claims “are not patentably distinct from each other.” (Ans. 2, see also 3–10.) Specifically, the Examiner finds, and Appellants do not contest that presently claimed SEQ ID NOs: 1–4 are identical to SEQ ID NOs: 47–50 of Fukui. (Ans. 2, 3 (“[T]he probes of [Fukui’s] claim 1, group 16 are identical to the probes recited in [the] claim[s] . . . of the instant application.”); App. Br. 14 (“One of the groups of probes recited in Fukui's claims (i.e., group 16) consists of SEQ ID NOs. 47 to 50, which correspond to SEQ ID NOs. 1 to 4 of the instant claims.”).) Thus, both Appellants and Examiner agree that Fukui disclosed the sequences as set out in SEQ ID NO: 1–4 of the present claims. We address Appellants’ arguments below. Appellants contend that “the Office fails to provide any articulated reasoning as to why the skilled artisan would be lead to the claimed combination of SEQ ID NOs. 1 to 4.” (App. Br. 15.) At issue is whether claim 8, of the present application is limited to the recited sequences or whether the claim can accommodate additional sequences and still be within the claimed scope. 2 Fukui et al., US 7,906,286 B2, issued Mar. 15, 2011. Appeal 2013-001604 Application 12/120,172 4 Claim interpretation is at the heart of patent examination because a claim cannot be compared to the prior art before its scope is properly ascertained. In re Abbott Diabetes Care Inc., 696 F.3d 1142, 1146 (Fed. Cir. 2012)). Claim 8 is directed to a probe set for detecting a pathogenic fungus “wherein the probe set comprises” probes consisting of SEQ ID NOs: 1–4. (See Claims Appendix.) As recognized by the Examiner, comprises means the listed elements are essential but also allows for additional elements as well. (See Ans. 4.) “‘Comprising’ is a term of art used in claim language which means that the named elements are essential, but other elements may be added and still form a construct within the scope of the claim.” Genentech, Inc. v. Chiron Corp., 112 F.3d 495, 501 (Fed. Cir. 1997). We agree with the Examiner’s interpretation that claim 8 requires the probes of SEQ ID NOs: 1–4 but can include additional probes, even in large amounts, and still be within the bounds of the claim. “If the preamble adds no limitations to those in the body of the claim, the preamble is not itself a claim limitation and is irrelevant to proper construction of the claim.” IMS Technology, Inc. v. Haas Automation, Inc., 206 F.3d 1422, 1434 (Fed. Cir. 2000). Here, the preamble of claim 8 recites the limitation “for detecting an internal transcribed spacer (ITS) region of Epidermophyton floccosum which is a pathogenic fungus.” The probes, specifically identified in the claim body as SEQ ID NOs: 1–4, are specific for Epidermophyton floccosum. In other words, the probes recited in the claims contain a sting of nucleic acid sequences that are unique to the recited fungus, Epidermophyton floccosum. Thus, the recitation in the preamble that probes are used for identifying a particular pathogenic fungus is essentially just describing their intended use. See also Rowe v. Dror, 112 Appeal 2013-001604 Application 12/120,172 5 F.3d 473, 478 (Fed. Cir. 1997) (“where a patentee defines a structurally complete invention in the claim body and uses the preamble only to state a purpose or intended use for the invention, the preamble is not a claim limitation”). Accordingly, we find that the preamble does not add any additional limitation to the claim. “[T]he patentability of . . . composition claims depends on the claimed structure, not on the use or purpose of that structure.” Catalina Mktg. Int’l, Inc. v. Coolsavings.com, Inc., 289 F.3d 801, 809 (Fed. Cir. 2002). Accordingly, we interpret claim 8 to require a probe set that contains the recited sequences of SEQ ID NOs: 1–4, but can additionally include other sequences. Claim 1 of Fukui recites a method of identifying a fungal species by amplifying a portion of an ITS of a fungal genome and identifying a fugal species of the amplified nucleic acid. [W]herein the fungal species of the amplified nucleic acid is determined and identified by using a probe set comprising a plurality of nucleic acid probes . . . . . . . . [The] plurality of nucleic acid probes comprises: (1) a first probe belonging to any group selected from the following groups 1 to 29 and a second probe belonging to any group selected from the following groups 1 to 29 and not belonging to the group to which the first probe belongs, or (2) a third probe consisting of the complementary sequence of the first probe and a fourth probe consisting of the complementary sequence of the second probe. (Fukui, claim 1 (emphasis added).) Claim 9 of Fukui is directed to a kit for performing the method of claim 1, and it is this claim the Examiner relies on Appeal 2013-001604 Application 12/120,172 6 in making the obviousness-type double patenting rejection against claim 8 of the present Application. (See Ans. 2.) The Examiner begins by interpreting what is encompassed by the claims of the Fukui patent. (See Ans. 5–6.) We find that the Examiner has reasonably interpreted that Fukui’s claim 1 minimally requires two probes and those probes must be selected from different groups. (See Id.) We also agree with the Examiner’s interpretation that the claim language of Fukui, does not limit the number of probes and therefore can include “all 78” of the remaining probes recited in claim 1 as well. (Id. at 6.) As recognized by the Examiner, claim 9 of Fukui recites a kit that including the probes as recited in claim 1. (Id. at 2.) Because Fukui’s claims are not limited to using only 2 probes and can reasonably be interpreted to including all 80 probes recited, we agree with the Examiner’s conclusion that the claims of the present invention are obvious in light of Fukui’s claims. Appellants contend that “nowhere is Fukui seen to disclose the use of these four sequences together.” (App. Br. 14.) We are not persuaded. Here, the present claims are not limited to the four sequences recited in the claim but instead are open to include additional probes even in large amounts. Both Appellants and Examiner agree that Fukui disclosed the sequences as set out in SEQ ID NOs: 1–4 of the present claims. (See Ans. 6 and App. Br. 14.) As discussed above, because Fukui’s claims can reasonably include all 80 probes recited in the claims, including SEQ ID NO: 47–50, Fukui’s claims encompass the presently recited probe set. Furthermore, because Fukui’s probes as set out in SEQ ID NOs: 47–50 are identical to the presently claimed probes (see Ans. 6 and App. Br. 14), they would detect the same organism. Thus, a prima facie case of either anticipation or Appeal 2013-001604 Application 12/120,172 7 obviousness has been established. See In re Best, 562 F.2d 1252, 1255 (CCPA 1977). Because claim 8 of the present application is not limited to the four recited probes and is open to additional probes, we agree with the Examiner’s conclusion that although “the conflicting claims are not identical, they are not patentably distinct from each other.” (Ans. 2.) Appellants contend that the Examiner improperly relied on Fukui’s disclosure in formulating the rejection, specifically, looking to the disclosure “which describes that group 16 (SEQ ID NOs. 47 to 50, which correspond to instant SEQ ID NOs. 1 to 4) has the function of detecting Epidermophyton floccosum.” (Reply Br. 8.) We are not persuaded. Although the Examiner notes that Fukui’s specification discloses that the group 16 probes, recited in Fukui’s claim 1, are specific for Epidermophyton floccosum (see Ans. 9), the Examiner relies on the sequence identity of the probes themselves in formulating the rejection. (See Ans. 3 (“it is noted that the probes of claim 1, group 16 [of Fukui] are identical to the probes recited in . . . the instant application”).) While we agree that obviousness-type double patenting must be based on the claims, “this does not mean that the court must close its eyes to the specification entirely. For example, the court may look to the specification to define terms found in the claims.” In re Hitachi Metals, Ltd., 603 Fed. Appx. 976, 979 (Fed. Cir. 2015). Because the presently claimed sequences disclosed in SEQ ID NOs: 1–4 are unique to the internal transcribed spaces of Epidermophyton floccosum, and identical to Fukui’s probes SEQ ID NOs: 47–50 (see Ans. 6 and App. Br. 14) these sequences would inherently detect the recited fungus. Appeal 2013-001604 Application 12/120,172 8 We conclude that the preponderance of the evidence of record supports the Examiner’s conclusion that the claims are not patentably distinct. SUMMARY We affirm the rejection of claims 8, 9, 12, 13, and 15 on the ground of nonstatutory obviousness-type double patenting over claims 1–10 of Fukui. TIME PERIOD FOR RESPONSE No time period for taking any subsequent action in connection with this appeal may be extended under 37 C.F.R. § 1.136(a). AFFIRMED cdc