Ex Parte Robertson et al

Patent Trial and Appeal Board

Nov 28, 2012

11083583 (P.T.A.B. Nov. 28, 2012)

UNITED STATES PATENT AND TRADEMARKOFFICE
UNITED STATES DEPARTMENT OF COMMERCE
United States Patent and Trademark Office
Address: COMMISSIONER FOR PATENTS
P.O. Box 1450
Alexandria, Virginia 22313-1450
www.uspto.gov
APPLICATION NO. FILING DATE FIRST NAMED INVENTOR ATTORNEY DOCKET NO. CONFIRMATION NO.
11/083,583 03/18/2005 Gavin P. Robertson P06710US01 4393
7590 11/28/2012
Julie K. Staple, Esq.
GIFFORD, KRASS, SPRINKLE,
ANDERSON & CITKOWSKI, P.C.
PO Box 7021
Troy, MI 48007-7021
EXAMINER
SHIN, DANA H
ART UNIT PAPER NUMBER
1635
MAIL DATE DELIVERY MODE
11/28/2012 PAPER
Please find below and/or attached an Office communication concerning this application or proceeding.
The time period for reply, if any, is set in the attached communication.
PTOL-90A (Rev. 04/07)
UNITED STATES PATENT AND TRADEMARK OFFICE
__________

BEFORE THE PATENT TRIAL AND APPEAL BOARD
__________

Ex parte GAVIN P. ROBERTSON,
LAKSHMAN SANDIRASEGARANE, MARK KESTER,
and ARATI SHARMA
__________

Appeal 2011-009971
Application 11/083,583
Technology Center 1600
__________

Before DONALD E. ADAMS, FRANCISCO C. PRATS, and
JEFFREY N. FREDMAN, Administrative Patent Judges.

PRATS, Administrative Patent Judge.

DECISION ON APPEAL
This appeal under 35 U.S.C. § 134 involves claims to a composition
for treating a melanoma tumor. The Examiner entered rejections for
obviousness.
We have jurisdiction under 35 U.S.C. § 6(b). We affirm.
STATEMENT OF THE CASE
Appellants’ invention is directed to the use of “‘small interfering
RNA’ (siRNA) polynucleotides that interfere with expression of specific
Appeal 2011-009971
Application 11/083,583

2
polypeptides in higher eukaryotes such as mammals (including humans)”
(Spec. 6). In particular, the “present invention is directed in part to the
discovery that Akt3 is an important serine/threonine protein kinase, and
plays a role in melanoma survival so that melanoma tumor cells are resistant
to apoptosis” (id. at 17).
Thus, Appellants define “siRNA” essentially as a small interfering
RNA molecule that inhibits expression of the Akt3 gene:
[T]he term “siRNA” means either: (i) a double stranded
RNA oligonucleotide, or polynucleotide, that is 18 . . . [to] 30
base pairs in length and that is capable of interfering with
expression and activity of a Akt3 polypeptide, or a variant of
the Akt3 polypeptide . . .; (ii) a single stranded oligonucleotide,
or polynucleotide of 18 . . . [to] 30 nucleotides in length and
that is either capable of interfering with expression and/or
activity of a target Akt3 polypeptide, or a variant of the Akt3
polypeptide . . .; or (iii) an oligonucleotide, or polynucleotide,
of either (i) or (ii) above wherein such oligonucleotide, or
polynucleotide, has one, two, three or four nucleic acid
alterations or substitutions therein.

(Spec. 18.)
Claims 36, 37, and 56 stand rejected and appealed (App. Br. 1).
Claims 36 and 56 are illustrative and read as follows:
36. A composition for treating a melanoma tumor comprising:
a small interfering RNA (siRNA) molecule that reduces Akt3 activity,
wherein said small interfering RNA (siRNA) molecule comprises:
the complement of a polynucleotide
5' GAUGAAGAAUUUACAGCUCAGACUA 3' (SEQ ID NO:6) and
a carrier.

56. The composition of claim 36 wherein said composition further
comprises a siRNA molecule that reduces B-Raf activity.

Appeal 2011-009971
Application 11/083,583

3
The following rejections are before us for review:
(1) Claims 36, 37, and 56, under 35 U.S.C. § 103(a) as obvious over
Hingorani,1 Gleave,2 Khvorova,3 and Dhawan4 (Ans. 5-8); and
(2) Claim 56, under 35 U.S.C. § 103(a) as obvious over
Muniz-Medina,5 Stahl,6 and Khvorova (Ans. 8-11).
As we find the second rejection merely cumulative to the first
rejection, we do not address it further.
OBVIOUSNESS –
HINGORANI, GLEAVE, KHVOROVA, AND DHAWAN
The Examiner cited Hingorani as evidence that an ordinary artisan
would have been prompted to treat melanoma with a B-Raf-targeted siRNA,
but conceded that Hingorani did not teach combining the B-Raf-targeted
siRNA with an Akt3-targeted siRNA comprising SEQ ID NO:6, as the
claims require (see Ans. 5). To address that deficiency, the Examiner cited
Gleave as disclosing not only that B-Raf-targeted siRNA was useful for
treating melanoma, but also that other anti-cancer agents could be combined
with the B-Raf-targeted siRNA in the treatment (id. at 5-6). The Examiner

1 Sunil Hingorani et al., Suppression of BRAFV599E in Human Melanoma
Abrogates Transformation, 63 CANCER RESEARCH 5198-5202 (2003).
2 U.S. Patent App. Pub. No. 2004/0096882 A1 (filed August 23, 2003).
3 U.S. Patent App. Pub. No. 2005/0245475 A1 (filed March 18, 2005).
4 Punita Dhawan et al., Constitutive Activation of Akt/Protein Kinase B in
Melanoma Leads to Up-Regulation of Nuclear Factor-κB and Tumor
Progression, 62 CANCER RESEARCH 7335-7342 (2002).
5 Vanessa M. Muniz-Medina et al., The role of B-Raf in melanoma and
colorectal carcinoma, 45 PROC. AMER. ASSOC. CANCER. RES., ACCR
Meeting Abstract No. 5055 (2004).
6 Jill M. Stahl et al., Deregulated Akt3 Activity Promotes Development of
Malignant Melanoma, 64 CANCER RESEARCH 7002-7010 (2004).
Appeal 2011-009971
Application 11/083,583

4
cited Dhawan as evidence that Akt3 was up-regulated in metastatic
melanoma cells, and that an ordinary artisan would therefore have been
prompted to inhibit Akt3 expression as part of a melanoma treatment (see id.
at 6-7).
The Examiner concluded that an ordinary artisan would have
considered it obvious “to make a combination anti-melanoma siRNA
composition comprising an anti-B-Raf siRNA of Hingorani et al. or Gleave
et al. and an anti-Akt3 siRNA having SEQ ID NO:6” (id. at 7). The
Examiner reasoned that the artisan would have been prompted to make the
combination “because targeting two known, identified anti-melanoma target
genes, B-Raf and Atk3, was independently known in the art, and because
making a combination composition comprising two anti-cancer agents was
known in the art as taught by Gleave” (id.).
The Examiner combined two lines of evidence to show that an
ordinary artisan would have considered it obvious to select, from the known
Akt3 mRNA sequence, SEQ ID NO:6 as the Atk3 subsequence targeted by
an siRNA molecule in a melanoma treating composition. The Examiner first
noted that Appellants’ claim 36’s SEQ ID NO:6 contains within it a 19-mer
subsequence, identical to Appellants’ SEQ ID NO:2, that meets the
AA(N19)UU motif used by Gleave to select its siRNA targets (id. at 6).
The Examiner also cited Khvorova as disclosing a “‘rational design’”
protocol for selecting siRNA sequences from target mRNA molecules,
including Akt3, and noted in particular that Khvorova disclosed an siRNA
molecule with a sequence identical to that of Appellants’ SEQ ID NO:2 (id.
at 6). The Examiner noted that Appellants’ SEQ ID NO:2 met seven of the
eight criteria applied in Khvorova’s rational design scheme (id. at 16).
Appeal 2011-009971
Application 11/083,583

5
The Examiner also noted that Khvorova taught that siRNA molecules
should be from 18 to 30 base pairs in length, and that when making siRNA
molecules longer than 19 base pairs in length, the additional bases should be
added to the 5´ end of the sense strand of the targeted molecule (id. at 6).
The Examiner further noted that the six nucleotides added to SEQ ID NO:2
to result in SEQ ID NO:6 were added at the 5´ end (id. at 20).
The Examiner thus reasoned that an ordinary artisan using the siRNA
selection protocols of Gleave and Khvorova “would have reasonably
obtained the 19-mer subsequence of SEQ ID NO:6, wherein the subsequence
is SEQ ID NO:2 of the instant application because the 19-mer subsequence
satisfies the siRNA design/identification protocol disclosed in either of the
references” (id. at 8). The Examiner further reasoned that arriving at a
sequence complementary to SEQ ID NO:6 from the 19-mer of SEQ ID
NO:2 would have been obvious cased on Khvorova’s disclosure of the
suitability of adding up to 11 bases to the 5´ end of such 19-mers (see id.)
As stated in In re Oetiker, 977 F.2d 1443, 1445 (Fed. Cir. 1992):
[T]he examiner bears the initial burden . . . of presenting a
prima facie case of unpatentability. . . .
After evidence or argument is submitted by the applicant
in response, patentability is determined on the totality of the
record, by a preponderance of evidence with due consideration
to persuasiveness of argument.

We select claim 36 as representative of the rejected claims. See 37
C.F.R. § 41.37(c)(1)(vii).
Appellants’ arguments do not persuade us that a preponderance of the
evidence fails to support the Examiner’s conclusion that claim 36 would
have been prima facie obvious to an ordinary artisan.
Appeal 2011-009971
Application 11/083,583

6
Claim 36 recites a composition for treating a melanoma tumor. The
composition must contain a carrier and an siRNA molecule that reduces
Akt3 activity. The siRNA molecule must include the complement of the 25
nucleotide sequence described by Appellants’ SEQ ID NO:6.
As the Examiner found (see Ans. 7), the Akt3 mRNA sequence was
known (see, e.g., Khvorova, Table VI (Akt3 sequence used was Accession
Number NM_005465, one of the Akt3 sequences employed by Appellants
(see Spec. 20:23-25)).
As the Examiner also found, the Atk3 gene was known to be involved
in a pathway suitable for targeting with an siRNA molecule (see Khvorova
[0459]; see also Dhawan 7341 (Akt gene “plays an important role in human
melanoma” including activation of “a number of diverse downstream
proliferative and anti-apoptotic pathways and this is a promising target for
future molecular based therapy.”)).
As the Examiner further found, Khvorova teaches that, when
employing siRNA molecules to reduce the activity of a gene of interest, the
siRNA molecules should be 18 to 30-mers which are complementary to a
target subsequence selected from within the mRNA of the gene (see
Khvorova [0167]; see also Gleave [0032] (16 to 29-mers described as
“preferred RNA molecules”)).
Appellants do not dispute that SEQ ID NO:6 is a 25-mer subsequence
of the known Akt3 mRNA sequence (see Spec. 53 (as amended October 12,
2007)), and therefore falls within the suitable size range described by
Khvorova and Gleave.
As the Examiner found, SEQ ID NO:6 contains within it a 19 base
subsequence, described by Appellants as SEQ ID NO:2 (see id.). As the
Appeal 2011-009971
Application 11/083,583

7
Examiner also found, SEQ ID NO:2 is a sequence that complies with the
AA(N19)UU motif described by Gleave as being suitable for selecting
siRNA target subsequences from the mRNA sequence of a gene of interest
(see Gleave [0056]).
As the Examiner further found, SEQ ID NO:2 is a sequence that also
meets seven of eight criteria described by Khvorova as being desirable for
selecting siRNA target subsequences from the mRNA sequence of a gene of
interest (Ans. 16, see also, Khvorova [0272] (Table IV)).
While the Examiner conceded that claim 36’s SEQ ID NO:6 included
six additional bases at the 5´ end of the sequence of SEQ ID NO:2 (Ans. 20),
as the Examiner pointed out, because Khvorova’s selection criteria are based
on a target sequence 19 base pairs in length (Khvorova [0167]), once a
suitable 19 base target sequence is identified, “[w]hen there are twenty to
thirty bases present, then additional bases are added at the 5´ end of the
sense strand” (id. at [0168]).
Thus, the evidence advanced by the Examiner shows that claim 36’s
siRNA molecule, complementary to SEQ ID NO:6, not only falls within the
size range described by Gleave and Khvorova as being suitable for siRNA,
but is complementary to a 25-mer subsequence within the known Akt3
mRNA sequence. Moreover, claim 36’s siRNA molecule is also
complementary to a 19-mer motif that meets selection criteria used by both
Gleave and Khvorova. While claim 36 requires its siRNA molecule to have
complementarity to a sequence that includes at least six bases in addition to
the 19 base sequence that would be selected using the criteria of Gleave and
Khvorova, the additional bases are at the 5´ end, in accordance with
Khvorova’s teachings, as the Examiner points out (Ans. 20).
Appeal 2011-009971
Application 11/083,583

8
Therefore, because the target Akt3 mRNA sequence and siRNA size
and sequence selection criteria were known in the art, we are not persuaded
that selecting the siRNA target sequence recited in claim 36 from the known
Akt3 mRNA sequence would have been a matter of blind selection from
over 1.5 million potential sequences, as Appellants argue (see App. Br. 4-5;
see also Reply Br. 5). Moreover, while Appellants argue to the contrary (see
App. Br. 5-7; see also Kester Declaration ¶ 10);7 the Examiner’s alignment
of SEQ ID NO:2 and SEQ ID NO:6 (see Ans. 20), supports the Examiner’s
position that the additional bases required by claim 36 to be targeted by the
siRNA molecule would have been added only in accordance with
Khvorova’s teachings, as noted above.
It may be true, as Appellants argue (App. Br. 4-5; Reply Br. 6; Kester
Declaration ¶ 9), that the Akt3 sequences specifically targeted by Khvorova
are different than that recited in claim 36 (see Khvorova, Table VI). As the
Federal Circuit has pointed out, however, a “finding that the prior art as a
whole suggests the desirability of a particular combination need not be
supported by a finding that the prior art suggests that the combination
claimed by the patent applicant is the preferred, or most desirable,
combination.” In re Fulton, 391 F.3d 1195, 1200 (Fed. Cir. 2004).
Thus, even if Khvorova describes certain Akt3 subsequences as being
preferred siRNA targets, given that the sequence targeted by claim 36’s
siRNA meets size and sequence selection criteria applied not only by
Khvorova, but also Gleave, we are not persuaded that an ordinary artisan

7 Declaration of Dr. Mark Kester under 37 C.F.R. § 1.132 (declaration
executed April 3, 2010).
Appeal 2011-009971
Application 11/083,583

9
lacked adequate impetus for selecting SEQ ID NO:6 from the Akt3 mRNA
sequence as a useful target for an siRNA molecule.
Moreover, because an ordinary artisan have recognized, for the
reasons discussed above, that an siRNA molecule complementary to SEQ ID
NO:6 met the criteria characteristic of an active siRNA molecule, we are not
persuaded that the artisan lacked a reasonable expectation that preparing an
siRNA molecule targeted to the subsequence of the Akt3 mRNA sequence
corresponding to SEQ ID NO:6 would inhibit Akt3 activity. It is well
settled that “[o]bviousness does not require absolute predictability of
success. . . . For obviousness under § 103, all that is required is a reasonable
expectation of success.” In re O’Farrell, 853 F.2d 894, 903-04 (Fed. Cir.
1988); accord, In re Kubin, 561 F.3d 1351, 1359-61 (Fed. Cir. 2009).
Accordingly, for the reasons discussed, Appellants’ arguments do not
persuade us that a preponderance of the evidence fails to support the
Examiner’s prima facie case of obviousness as to claim 36. We therefore
affirm the Examiner’s rejection of that claim over Hingorani, Gleave,
Khvorova, and Dhawan.
Claims 37 and 56 fall with claim 36. See 37 C.F.R. § 41.37(c)(1)(vii).

SUMMARY
We affirm the Examiner’s rejection of claims 36, 37, and 56 as
obvious over Hingorani, Gleave, Khvorova, and Dhawan.
We do not address the Examiner’s cumulative obviousness rejection
of claim 56 over Muniz Medina, Stahl, and Khvorova.

Appeal 2011-009971
Application 11/083,583

10
TIME PERIOD
No time period for taking any subsequent action in connection with
this appeal may be extended under 37 C.F.R. § 1.136(a).

AFFIRMED

dm